Indian Journal of Urology Users online:554  
IJU
Home Current Issue Ahead of print Editorial Board Archives Symposia Guidelines Subscriptions Login 
Print this page  Email this page Small font sizeDefault font sizeIncrease font size


 
  Table of Contents 
ORIGINAL ARTICLE
Year : 2014  |  Volume : 30  |  Issue : 3  |  Page : 241-244
 

Metallothionein gene expression in renal cell carcinoma


1 Department of Biochemistry, PGIMER, Chandigarh, India
2 Department of Urology, PGIMER, Chandigarh, India

Date of Web Publication1-Jul-2014

Correspondence Address:
Rajendra Prasad
Department of Biochemistry, PGIMER, Chandigarh
India
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/0970-1591.134242

Rights and Permissions

 
   Abstract 

Introduction: Metallothioneins (MTs) are a group of low-molecular weight, cysteine-rich proteins. In general, MT is known to modulate three fundamental processes: (1) the release of gaseous mediators such as hydroxyl radical or nitric oxide, (2) apoptosis and (3) the binding and exchange of heavy metals such as zinc, cadmium or copper. Previous studies have shown a positive correlation between the expression of MT with invasion, metastasis and poor prognosis in various cancers. Most of the previous studies primarily used immunohistochemistry to analyze localization of MT in renal cell carcinoma (RCC). No information is available on the gene expression of MT2A isoform in different types and grades of RCC.
Materials and Methods: In the present study, total RNA was isolated from 38 histopathologically confirmed cases of RCC of different types and grades. Corresponding adjacent normal renal parenchyma was taken as control. Real-time polymerase chain reaction (RT PCR) analysis was done for the MT2A gene expression using b-actin as an internal control. All statistical calculations were performed using SPSS software.
Results: The MT2A gene expression was found to be significantly increased (P < 0.01) in clear cell RCC in comparison with the adjacent normal renal parenchyma. The expression of MT2A was two to three-fold higher in sarcomatoid RCC, whereas there was no change in papillary and collecting duct RCC. MT2A gene expression was significantly higher in lower grade (grades I and II, P < 0.05), while no change was observed in high-grade tumor (grade III and IV) in comparison to adjacent normal renal tissue.
Conclusion: The first report of the expression of MT2A in different types and grades of RCC and also these data further support the role of MT2A in tumorigenesis.


Keywords: Clear cell carcinoma, grade, metallothionein, renal cell carcinoma, Real time polymerase chain reaction


How to cite this article:
Pal D, Sharma U, Singh SK, Mandal AK, Prasad R. Metallothionein gene expression in renal cell carcinoma. Indian J Urol 2014;30:241-4

How to cite this URL:
Pal D, Sharma U, Singh SK, Mandal AK, Prasad R. Metallothionein gene expression in renal cell carcinoma. Indian J Urol [serial online] 2014 [cited 2018 Dec 10];30:241-4. Available from: http://www.indianjurol.com/text.asp?2014/30/3/241/134242


.
   Introduction Top


Metallothioneins (MTs) are a group of low-molecular weight, cysteine-rich intracellular proteins that are encoded by a family of genes containing at least 10 functional isoforms in humans. [1] MT is thought to be an important intracellular storage site for zinc, and possibly other essential trace elements. [2] MT1 and MT2 isoforms are usually expressed in low levels, but are inducible by a variety of metal ions, hormones, inflammatory cytokines and xenobiotics. [3] Previous studies have shown that MT has a role in the development of drug resistance in tumor cells. [4] This protein has properties like detoxification of heavy metals like mercury and cadmium, homeostasis of essential metals including copper and zinc and antioxidation against reactive oxygen species. MTs also have a role in the cellular repair process, cell proliferation, differentiation and carcinogenesis. [5] MT synthesis is regulated by the rate of MT gene transcription, which in turn is mediated by interactions between upstream regulatory DNA sequences and unidentified cellular factors. [6] Changes in gene structure such as amplification, methylation and cellular differentiation and development can alter MT expression. [7] The expression of MT has been demonstrated in various types of human tumors, including thyroid, [8] testicular germ cell tumor, [9] urinary bladder tumor, [10] salivary gland [11] and prostate tumor. [12] There is direct evidence that certain tumors have enhanced levels of MT, and that induction of these metallo-proteins is often associated with rapidly proliferating cells. [3]

Metallothionein as a potential biomarker is at the center of interest and its properties, function and behavior under various conditions are intensively studied. [13] New biological roles for these proteins have been identified, including those needed in the carcinogenic process. However, their use as a predictive marker remains controversial. Several reports have disclosed MT expression as a prognostic factor for tumor progression and drug resistance in a variety of malignancies, particularly breast, prostatic, ovarian, head and neck, non-small cell lung cancer, melanoma and soft tissue sarcoma. [14] Previous studies reported increased levels of MT1 and MT2 mRNA and protein expression in various human cancers, such as breast, kidney, lung, nasopharyngeal, ovarian, prostate, salivary gland, testicular, urinary bladder, cervical and endometrial cancers, as well as skin carcinoma and melanoma. [15] However, MT1 and MT2 are down-regulated in other types of tumors, e.g. hepatocellular, [16] gastric, [17] colorectal [18] and liver adenocarcinoma. [19]

Renal cell carcinoma (RCC) is the most common renal tumor, accounting for approximately 3% of adult malignancies and constituting 90% of all renal malignancies. [20] Previous studies have shown an increase in immunoreactivity in lower stage tumor, suggesting a role of MT in enhancing the proliferative response of tumor cells during their growth cycle. [3],[4],[21] A number of studies have also demonstrated altered MT2A protein expression in RCC by the immunostaining approach. [3] While most of these studies primarily used immunohistochemistry to analyze the localization and protein level of MT2A in tumor cells, no information is available on the gene expression of MT2A isoform in different grades and subtypes of RCC. In this study, we investigated the gene expression of MT2A isoforms in various subtypes and grades of RCC.


   Materials and methods Top


Patients

The present study was approved by the institute ethics committee and has been performed in accordance with the ethical standards laid down in an appropriate version of the 2000 Declaration of Helsinki as well as the Declaration of Istanbul, 2009. Informed consent was obtained from all patients before conducting the study. Following nephrectomy, tissue samples were taken from the tumor and grossly normal renal parenchyma separately. The samples were snap-frozen in liquid nitrogen and stored at -80°C till further use. Grading of tumors was performed by the Fuhrman grading system. [22]

RNA isolation

Total RNA was isolated from tumorous and normal adjacent kidney tissue using the PureLink TM RNA mini Kit (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's protocol. The concentration and purity of each sample were evaluated using a spectrophotometer at A260/A280. A total of 10 μg total RNA was treated with 1 U DNase I (Fermentas) for 30 min at 37°C and then heat-inactivated at 65°C for 10 min before reverse transcription to eliminate genomic DNA (gDNA) contamination.

cDNA preparations

For first-strand cDNA synthesis, 1 μg of treated RNA in a final volume of 20 μL was used to synthesize cDNA using a super script III first strand synthesis system (Invitrogen). The mixture was incubated at 42°C for 1 h. RNA without DNase I treatment was used as a control to test gDNA contamination. After first strand synthesis, the reactions were heat-inactivated at 70°C for 5 min.

Real time polymerase chain reaction

Oligonucleotide primers were MT 2A, CTCCA AGTCCCAGCGAAC and GAGCAGTTGG GATCCATGG; β-actin, CGTGACATTAAGGAGAAGCTG and CTAGAAG CATTTGCGGTG GAC. Real time analysis was performed on a 7300 RT PCR system (Roche, Indianapolis, IN, USA) using the SYBR Green PCR Master Mix (TaKaRa, Madison, WI, USA). β-actin was used as an internal control. For MT2A and β-actin gene amplification, 1 μL of the synthesized first strand cDNA was used. The cycles were programmed for 95°C for a 2-min initial step, then 95°C for 30 s, 62°C for 30 s and 72°C for 30 s. Each assay included a no-template control and a cDNA template (in triplicate). The expression levels of MT2A were normalized to the β-actin transcript level and calculated to MT2A levels in normal renal parenchyma using the following equation:

Relative expression: 2 -(sampleΔCt-ControlΔCt) ; where ΔCt = average Ct (MT2A) - averageΔCt(β-actin).

Specificity of the PCR products was confirmed by analyzing the dissociation curve.

Statistical analysis

Data were expressed as mean ± SD. Statistical analyses was performed based on an independent samples t-test to compare data. P value less than 0.05 is considered statistically significant.


   Results Top


Patients' characteristics

A total of 38 cases of histopathologically proven RCC and corresponding controls were included in this study. Various characteristics of the patients included in this study are shown in [Figure 1]. The patients were in the age group of 35-76 years, with a mean age of 52.3 ± 13.8 years. Most of the patients were in their 5 th to 6 th decades of life [Figure 1]a]. Of a total of 38 cases of RCC, 30 cases were of clear cell carcinoma, four cases were of papillary cell carcinoma, three cases were of sarcomatoid carcinoma and one case was of collecting duct carcinoma [Figure 1]b]. The 30 cases of clear cell carcinoma included four cases of grade I, ninteen cases of grade II, five cases of grade III and two cases of grade IV [Figure 1]c].
Figure 1: Patients' characteristics. (a) Bar diagram showing the number of patients in the different age groups. (b) Pie diagram showing the number of patients in the different types of renal cell carcinoma. (c) Bar diagram showing the number of patients in the different grades of clear cell carcinoma

Click here to view


Relative quantification of MT gene expression

[Figure 2] shows the quality of isolated RNA from different tissues. Quantitation of the expression profile of MT2A gene included the use of β-actin as a housekeeping gene for comparison. When compared with the corresponding normal renal parenchyma, quantitative relative expressions for MT2A were found to be significantly increased in clear cell carcinoma as compared with corresponding normal renal tissue [P < 0.01; [Table 1], whereas the MT2A expression was two- to three-fold higher in sarcomatoid carcinoma compared with normal renal tissue [Table 1]. On the other hand, there was no change in the expression of MT2A in papillary and collecting duct carcinoma as compared with their corresponding normal tissues [Table 1]. Further, when the MT2A expression was determined in different grades of clear cell carcinoma, MT2A expression was found to be significantly increased in lower grade (P < 0.05 in grade I and grade II; [Table 1]), whereas no significant change was observed in the higher grades (grade II and grade IV) clear cell carcinoma [Table 1] when compared with adjacent normal renal tissue. [Figure 3]a shows the amplification curves and [Figure 3]b shows the melting peaks of different samples. A single melting peak shows the specific amplified product in each sample.
Table 1. Relative fold change in mRNA expression of MT2A gene in different types and grades of renal cell carcinoma

Click here to view
Figure 2: Analysis of total RNA. Total RNA were isolated from renal cell carcinoma and adjacent normal tissue and visualized on 1% formaldehyde agarose gel after ethidium bromide staining. Two bands corresponding to 28S and 18S rRNA were visualized, which are the hallmark of good-quality RNA. Lane C represents control RNA, lane N represents total RNA from normal tissue and lane T represents total RNA from the corresponding tumor tissue

Click here to view
Figure 3: Real time polymerase chain reaction analysis of metallothioneins 2A gene in tumor and normal kidney tissue. (a) SYBR Green fl uorescence history versus cycle number of MT2A and & â-actin;-actin in normal and tumor cDNA. (b) Melting peaks of the different RT PCR amplifi cation products

Click here to view



   Discussion Top


The primary goal of this study was to determine the expression profile of MT2A gene in different types and grades of RCC by RT PCR. In the present study, increased MT2A gene expression in lower grades (grade I and II) RCC indicates a possible role of MT2A in tumor growth and dedifferentiation. Our results are consistent with the previous studies. [4],[23],[24] There is no obvious explanation for the observation that lower grade tumors had increased MT2A gene expression relative to the other tumors in this study. However, one possible explanation is that the synthesis of MT may depend on the cell cycle, and it has been demonstrated that MT is preferentially expressed in S phase cells. [2],[25] Notwithstanding, we observed difference in MT2A gene expression in various types of RCC but because of the small sample size in different subgroups of RCC, we could not draw any considerable conclusion related MT2A expression in various forms of RCC.

In conclusion, this is the first study on MT2A gene expression in different types and grades of RCC. However, further studies are required to understand the role of MT in renal cell carcinoma carcinogenesis.

 
   References Top

1.Cherian MG, Jayasurya A, Bay BH. Metallothioneins in human tumors and potential roles in carcinogenesis. Mutat Res 2003;533:201-9.  Back to cited text no. 1
    
2.Cherian MG, Howell SB, Imura N, Klaassen CD, Koropatnick J, Lazo JS, et al. Role of metallothionein in carcinogenesis. Toxicol Appl Pharm 1994;126:1-5.  Back to cited text no. 2
    
3.Mitropoulos D, Kyroudi-Voulgari A, Theocharis S, Serafetinides E, Moraitis E, Zervas A, et al. Prognostic significance of metallothionein expression in renal cell carcinoma. World J Surg Oncol 2005;3:5.  Back to cited text no. 3
    
4.Izawa JI, Moussa M, Cherian MG, Doig G, Chin JL. Metallothionein expression in renal cancer. Urology 1998;52:767-72.  Back to cited text no. 4
    
5.Cherian, MG, Huang PC, Klaassen CD, Liu YP, Longfellow DG, Waalkes MP. National cancer institute workshop on the possible roles of Metallothionein in carcinogenesis. Cancer Res 1993;53:922-5.  Back to cited text no. 5
    
6.Kagi JH, Schaffer A. Biochemistry of metallothionein. Biochemistry 1988;27:8509-15.  Back to cited text no. 6
    
7.Hamer DH. Metallothionein. Annu Rev Biochem 1986;55:913-51.  Back to cited text no. 7
[PUBMED]    
8.Nartey N, Cherian MG, Banerjee D. Immunohistochemical localization of metallothionein in human thyroid tumours. Am J Pathol 1987;129:177-82.  Back to cited text no. 8
    
9.Kontozoglou TE, Banerjee D, Cherian MG. Immunohistochemical localization of metallothionein in human testicular embryonal carcinoma cells. Virchows Arch A Pathol Anat 1989;415:545-9.  Back to cited text no. 9
    
10.Bahnson RR, Banner BF, Ernstoff MS, Lazo JS, Cherian MG, Banerjee D, et al. Immunohistochemical localization of metallothionein in transitional cell carcinoma of the bladder. J Urol 1991;146:1518-20.  Back to cited text no. 10
    
11.Chauvin PJ, Cherian MG, Wysocki GP, Pringle G. A comparison of metallothionein expression in human normal and neoplastic salivary gland tissue using immunohistochemistry (abstract). Toxicologist 1992;12:379.  Back to cited text no. 11
    
12.Mousssa M, Kloth D, Peers G, Cherian MG, Frei JV, Chin JL. Metallothionein expression in prostate carcinoma: Correlation with Gleason grade, pathological stage, DNA content and serum level of prostate specific antigen. Clin Invest Med 1997;20:371-80.  Back to cited text no. 12
    
13.Ryvolova M, Hynek D, Skutkova H, Provaznik I, Kizek R. Structural changes in metallothionein isoforms revealed by capillary electrophoresis and Brdicka reaction. Electrophoresis 2012;33:270-9.  Back to cited text no. 13
    
14.Eckschlager T, Adam V, Hrabeta J, Figova K, Kizek R. Metallothioneins and cancer. Curr Protein Pept Sci 2009;10:360-75.  Back to cited text no. 14
    
15.Pedersen MO, Larsen A, Stoltenberg M, Penkowa M. The role of metallothionein in oncogenesis and cancer prognosis. Prog Histochem Cytochem 2009;44:29-64.  Back to cited text no. 15
    
16.Huang GW, Yang LY. Metallothionein expression in hepatocellular carcinoma. World J Gastroenterol 2002;8:650-3.  Back to cited text no. 16
    
17.Janssen AM, Van Duijn W, Kubben FJ, Griffioen G, Lamers CB, van Krieken JH, et al. Prognostic significance of metallothionein in human gastrointestinal cancer. Clin Cancer Res 2002;8:1889-96.  Back to cited text no. 17
    
18.Arriaga JM, Levy EM, Bravo AI, Bayo SM, Amat M, Aris M, et al. Metallothionein expression in colorectal cancer: Relevance of different isoforms for tumor progression and patient survival. Hum Pathol 2012;43:197-208.  Back to cited text no. 18
    
19.Thirumoorthy N, Shyam Sunder A, Manisenthil Kumar KT, Senthil Kumar M, Ganesh G, Chatterjee M. A review of metallothionein isoforms and their role in pathophysiology. World J Surg Oncol 2011;9:54.  Back to cited text no. 19
    
20.Sharma U, Singh SK, Pal D, Khajuria R, Mandal AK, Prasad R. Implication of BBM lipid composition and fluidity in mitigated alkaline phosphatase activity in renal cell carcinoma. Mol Cell Biochem 2012;369:287-93.  Back to cited text no. 20
    
21.Tuzel E, Kirkali Z, Yorukoglu K, Mungan MU, Sade M. Metallothionein expression in renal cell carcinoma: Subcellular localization and prognostic significance. J Urol 2001;165:1710-3.  Back to cited text no. 21
    
22.Fuhrman HA, Lasky LC, Limas C. Prognostic significance of morphologic parameters in renal cell carcinoma. Am J Surg Pathol 1982;6:655-63.  Back to cited text no. 22
    
23.Nguyen A, Jing Z, Mahoney PS, Davis R, Sikka SC, Agrawal KC, et al. In vivo gene expression profile analysis of Metallothionein in renal cell carcinoma. Cancer Lett 2000;160:133-40.  Back to cited text no. 23
    
24.Krizkova S, Fabrik I, Adam V, Hrabeta J, Eckschlager T, Kizek R. Metallothionein-a promising tool for cancer diagnostics. Bratisl Lek Listy 2009;110:93-7.  Back to cited text no. 24
    
25.Kondo Y, Rusnak JM, Hoyt DG, Settineri CE, Pitt BR, Lazo JS. Enhanced apoptosis in metallothionein null cells. Mol Pharmacol 1997;52:195-01.  Back to cited text no. 25
    


    Figures

  [Figure 1], [Figure 2], [Figure 3]
 
 
    Tables

  [Table 1]



 

Top
Print this article  Email this article
 

    

 
   Search
 
  
    Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
    Article in PDF (746 KB)
    Citation Manager
    Access Statistics
    Reader Comments
    Email Alert *
    Add to My List *
* Registration required (free)  


    Abstract
   Introduction
    Materials and me...
   Results
   Discussion
    References
    Article Figures
    Article Tables

 Article Access Statistics
    Viewed1753    
    Printed34    
    Emailed0    
    PDF Downloaded68    
    Comments [Add]    

Recommend this journal

HEALTHWARE INDIA